TRANSFORMASI Agrobakterium rhizogenese DAN INDUKSI AKAR RAMBUT PADA TANAMAN KAKAO (Theobroma cacao) UNTUK PRODUKSI SENYAWA ANTIOKSIDAN SECARA INVITRO

Sumaryati Syukur, Zozy Aneloi N, Femilya Putri

Abstract

 

ABSTRACT

 

Transformation of Ri T-DNA Plasmid Agrobacterium rhizogenese to varieties Theobroma cacao variety TSH which is growing in west Sumatra and induction of hairy roots in order to produce bioflavonoid antioxidant compounds such as, catechin, polyfenol, or monomer and oligomer flavones was successfully obtained. Three spesies of A.rhizogenese (A4,LBA 9457 and ATTCC 15834) originaly from LIPI was used to transform Ri T-DNA plasmid in MS medium via cacao embryo culture. The aim of this paper is to determine the affectivity and ability of the three species of bacterial above to produce hairy roots in cacao invitro culture. The statistical methods RAL was uses with 4 time treatments and 6 time repeated experiments. As treatment was bacterial inoculation and without inoculation as a control. The transformation result shows 2 of 3 of bacterial species have ability to induce hairy roots of.T cacao embryos counting by percentages of explants with producing hairy roots 16.66% for A4, 83.33% for LBA 9547 spesies.qualitative test of polyfenol from hairy roots transformants give (+4) as compared to non transform only (+1). Cathechin compound was determined by spectrophotometer as much as 0.1% for non transform and 0.87 % for hairy roots transformants by LBA 9547. Conformation of plasmid Ri T-DNA hairy roots from two transformants was analysis by PCR methods. The two primers rol B1 (52ATGGATCCCAAATTGCTTCCCCCACGA32) dan rol B2 (53 TTAGG CTTTCATTCGGGTTTACTGCAGC 33) was used. For TR-DNA the primes used is TRI (53 GGAAATTGTGGCGTTGTTGTGGAC 3’) and  TR2 (5’ AATCGTTCAGAGAGCGTCCGA AGTT 3’) . PCR analysis of DNA electrophoresis founded the band of TL region at 780 bp and TR at 1600 bp using DNA Ledder as DNA standard.

 

 

Keywords : transformation A.rhizogenese, PCR, Theobroma cacao, kultur embrio, kultur akar rambut, metabolit sekunder, cathechin

 

   

Full Text:

PDF

References

Kim, H, & Keeney, P. G. 1984. Epicatechin content in fermented and unfermented cocoa beans. Journal of Agricultural and Food Chemistry. 47. 3693-3701.

Sugawa. H, Kagami, dan Suzuki, 2004. High-frequency tranformation of Lobelia erinus L. by agrobactarium rhizogenes-mediated gene tranfer. Plant cell reports 22 (10): 759-764.

Toivonen, L. 1993. Utilization of hairy root cultures for production of secondary metabolites. Journal of Biotechnology. Prog. 9 : 12-20.

Giri, A., and M. L. Narasu, 2000. Transgenic Hairy Root : Recent Trends and Aplications. Biotechnology Advances. 18: 1-22.

Sanbogi, C., Osakabe, N., Natsume, M., Takizawa, T., Gomi, S., & Osawa, T. (1998). Antioxidative polyphenols isolated from Thoebroma cocoa. Journal of Agricultural and Food Chemistry, 46, 454–457.

Heiss C, Dejam A, Kleinbongard P,Schewe T,Sies H,Kelm M, 2003, Vascular effects of cocoa rich in flavan-3-ols.JAMA, 290:1030-1031.

Waterhouse AL,Shirley JR,Donovan JL, 1996, Antioxidants in chocolate[letter].Lancet, 348:834.

Bakhtiar, A. 2005. Potensi Senyawa Bahan Alam Flavonoid Sebagai Obat dan Kosmetik. Universitas Andalas. Padang.

Mei, Y. W., Wang, J.B., Luo, D., Jia, J. F. 2001. Regeneration of Plants From Callus Cultures of Roots Induced by Agrobacterium rhizogenes on Alhagipseudoalhagi. http://gob.oupjournals.org/cgi/content/abstracy/73/6/60.29 Mei 2005.

Ermayanti, T. M., L. Sari. E. M. R. Siregar & Sudrajat. D. 2000. Transformasi Mimba (Azadirachta indica A JUSS) dengan Agrobacterium rhizogenes galur ATCC 15834. Puslitbang Bioteknologi. LIPI.

Muswita. 1992. induksi kalus pada Kakao dengan Medium MS dengan Penambahan 2,4 D, IAA dan BA. Skripsi Sarjana Biologi. Universitas Andalas. Padang.

Orozco-Castillo, K., J. Chalmers, R. Waugh and W. Powell. 1994. Detection of Generic Diversity and Selective Gene Integration In Coffe Using RAPD Marker. Theor.Appl.Genet. 87: 934-938.

Sambrook, J.E., E.T. Fritsch and T. Maniatis. 1989. Molecular Cloning, A Laboratory Manual. Second Edition. Cold Spring Harbor Lab Press. New York p. 568-600.

Aoki, Y., H. Matsumoto, Y. Asako, Y. Matsunaga, and K. Shimomura. 1997. Variation Of Alkaloid Productivity Among Several Clones Of Hairy Roots and Generated Plants Of Atropa belladona Transformed With Agrobacterizum rhizogenes 15834. Plant Cell Reports 16: 282-286.

Winans.S. 1992. Two Ways Chemical Signalling Agrobactarium-plant interactions. Microbiol.rev. 56:12-31.

Noli, Z. A. 2004. Pertumbuhan dan Produksi Alkaloid Kinolina dari Kultur Akar Rambut Kina (Cinchona ledgeriana Moens dan C. succirubra Pavon ex Klotzsch) Hasil Transformasi Agrobacterium rhizogenes Glaur LBA 9457. Disertasi. Universitas Padjajaran. Bandung.

Sukmadjaja, D., dan P, Doran. 2001. Kinetik dan Karakteristik Pertumbuhan Kultur Akar Rambut dari Beberapa Genotipe Arabidopsis thaliana. Jurnal Bioteknologi Pertanian. Vol.6.No.2.pp.67-73.

Sumaryati, Desrina dan N.Z. Aneloi, 2006, Induksi akar rambut tanaman Gambir (Uncaria gambir Roxb) dengan plasmid Ri beberapa galur Agrobakterium rhizogenese secara In vitro, Laporan Penelitian, 1-51.

Bajaj, Y. P. S., and K. Ishimaru. 1999. Genetic Transformation of Medicinal Plant. In Bajaj, Y. P. S (eds). Biotechnology in Agriculture and Forestry, Transfenic Medicinal Plants. Springe-verlag. Berlin. 3-7.

Herlina N. D., 1995. Kepekaan Nilam (Pogostemon cablin Benth) Terhadap Infeksi Agrobacterium rhizogenes. Skripsi Sarjana Biologi. IPB, Bogor

Ercan, G. A., Taskin M., Turgut, K. dan Yuce, S. 1999. Agrobacterium rhizogenes-Mediated Hairy Root Formation in Some Rubia tinctorum L. Populations Grown in Turkey. Research Article 23 : 373-377.

Lodhi, A.H. and B.V Charlwood (1996). Agrobacterium rhizogenes mediated transformation of Rubia pregrine L. In vitro accunulation of Anthraquionones. Plant Cell Tiss. and Org. Cult. 46: 103-108.

Sheng, J., and Citovsky. 1996. Agrobacterium-plant Cell DNA Tranport, have Virulence Proteins will Travel. Plant Cell: 1699-1710.

Article Metrics

Metrics Loading ...

Metrics powered by PLOS ALM